Twitter | Search | |
Search Refresh
Rachel Dunleavey May 17
Me: Goes into the exam expecting a decent extract with Leah, Phil or Cathy Edexcel:
Reply Retweet Like
ihatesnakeu May 11
LISTEN UP YO CO-ARMYs LET'S GET TO WORK!!! LET'S GO FOR 1B!!! LET'S BEAT BLINKS!!!
Reply Retweet Like
EVIE🧜🏻‍♀️ May 17
Set,Sound and staging in 1 question ...I hate u GCSE Drama
Reply Retweet Like
PUPPY_OF_WOLFJIN🐺♡ 5h
Reply Retweet Like
Lekha Rudh 6h
Throwback to those maari days craze🥳😍💓 waiting for this combo 🙏💓💓
Reply Retweet Like
Zee News 5h
Watch your favourite show with
Reply Retweet Like
🔬⚗📝 6h
Daily : remittance 3' -> GCACTTTACTAATGATGACGATTAACACTT -> 5' (template) 5' <- CGTGAAATGATTACTACTGCTAATTGTGAA <- 3' (coding) (REMITTANCE) A sum of money remitted
Reply Retweet Like
The Epoch Times May 19
“In these cases, they are misrepresented as family members.” A pilot rapid -testing program revealed about 30% of arriving at the US-Mexico with children who were not theirs were unrelated to the children accompanying them.
Reply Retweet Like
Leo Calonder May 17
Nobody: GCSE Drama paper: hOw WoUlD yOu UsE sEt To mAkE tHe PlAy EnGaGiNg FoR tHe AuDiEnCe
Reply Retweet Like
🐳Tuğba Ortaç 5h
Turkish scientists at develop a computer program converting into music, visuals and animations by using frequency of chromosomes 🤓
Reply Retweet Like
Mamma Prada - Kristie Prada 19m
Who do you think you are? Given that we are all consumed with nationality at the moment I've just traced my DNA ancestry! Take a look at what it told me!
Reply Retweet Like
Phys.org May 15
Oldest Scandinavian human found in
Reply Retweet Like
WeToldYouNottoTell 14m
Wanting to know who your parents are is actually super common. 💫
Reply Retweet Like
NFSTC@FIU 5h
Shaking things up in the lab with the Forensic Course.
Reply Retweet Like
Harshit Dubey 🇮🇳🇮🇳 May 16
When gandhi die in 1991 so officer want of to match with gandhi to find his body so Sonia Gandhi refuse it and she don't gives of to officer it froofed that is not a son of gandhi 🙏🙏
Reply Retweet Like
Zee News 4h
: Nonstop News, 20th May 2019
Reply Retweet Like
Cristina, Gone Cold podcast 4h
Over the weekend, GEDmatch changed its terms of service – a new policy in which initially all DNA kits on GEDmatch will be set to opt-out of use by law enforcement. That means users on GEDmatch will now need to opt-in to help solve cold cases - please opt in!
Reply Retweet Like
Verissima Production 6h
Unfortunately, tests don't always lead to positive outcomes. Here are some surprises that others have encountered in their journey to learn more about their
Reply Retweet Like
MUM ON A MISSION 14h
Who doesn't love old pics :) The Giant gene
Reply Retweet Like

Related searches

@bts_twt
Shannon Christmas 6h
Reply Retweet Like